eliminate repeats in random module in python

Question

I have a code which generates a random sequence:

import random
selection60 = {"A":20, "T":20, "G":30, "C":30}
sseq60=[]
for k in selection60:
    sseq60 = sseq60 + [k] * int(selection60[k])
    random.shuffle(sseq60)
sequence="".join(random.sample(sseq60, 100))

The output in this case is:

GACCCCTCTGTACTATTAAAAGGCGTCACCGCGCCGAAAGAGCTGCAAGGCAATAGTGGACCAGAATCAAACGAAGGATTGCTTAGGTAATGGAATACAA

However, I would like to implement something that checks as well that no repeats of longer then 10 bases will be created for example:

GACCCCCCCCCCCTATTAAAAGGCGTCATCGCGCCGAAAGAGTTGCAAGGCAATAGTGGAGCAGAATTAAACGAAGGATTGCTTAGGTAATGGAATAAAA

This sequence contains 11 Cs at the beginning and it should not be allowed, the distribution of the letters should be uniform, is the random.sample function doing it by itself or does this need to be implemented?

Jamie Deith · Accepted Answer · 2021-05-11 06:03:11Z

1

The easiest to code is to check your sample and toss it if there are too many repeats:

from collections import Counter
from random import sample

pool = Counter({"A":20, "T":20, "G":30, "C":30})
too_many = [''.join([k]*11) for k in pool]
fn_select = lambda p: ''.join(sample(list(p.elements()), sum(p.values())))
selection = fn_select(pool)
while any(t in selection for t in too_many):
    selection = fn_select(pool)
print(selection)

Some detail:

too_many is set up as a list of 'illegal' sequences, i.e. ['AAAAAAAAAAA', 'TTTTTTTTTTT', 'GGGGGGGGGGG', 'CCCCCCCCCCC'].

any(t in selection for t in too_many) will be True if any of those 4 sequences are present in the selection, in which case we want to start fresh with a new sample.

Depending on your preference, you could rewrite the same code using a while True: loop:

from collections import Counter
from random import sample
pool = Counter({"A":20, "T":20, "G":30, "C":30})
too_many = [''.join([k]*11) for k in pool]
while True:
    selection = ''.join(sample(list(pool.elements()), sum(pool.values())))
    if not any(t in selection for t in too_many):
        break
print(selection)

edited May 11, 2021 at 6:03

answered May 11, 2021 at 4:24

Jamie Deith

7143 silver badges4 bronze badges

Sign up to request clarification or add additional context in comments.

3 Comments

Paolo Lorenzini Over a year ago

hi, so, can you explain please, what the any in the while loop does? it excludes the elements found in too_many?

Paolo Lorenzini Over a year ago

can you insert it in a nested while loop?

Jamie Deith Over a year ago

@PaoloLorenzini see edited response, hopefully answered your questions

Tim Roberts · Accepted Answer · 2021-05-11 03:48:10Z

1

Truly random sampling is sometimes going to generate long series of repeats. However, in this case, you're doing it wrong. Do the random shuffle after you generate the whole list. Do the shuffle a couple of times, if you want.

import random
selection60 = {"A":20, "T":20, "G":30, "C":30}
sseq60=[]
for k in selection60:
    sseq60 = sseq60 + [k] * int(selection60[k])
random.shuffle(sseq60)
sequence="".join(random.sample(sseq60, 100))

answered May 11, 2021 at 3:48

Tim Roberts

55.3k4 gold badges28 silver badges41 bronze badges

4 Comments

Paolo Lorenzini Over a year ago

I got it, so is the shuffle sufficient to avoid repeats?

Paolo Lorenzini Over a year ago

by the way, is there any way to check while a sequence is generated that it is less than 10% similar to the sequences already generated?

Paolo Lorenzini Over a year ago

I would like to remove a sequence which has more than 10 percent similarity to any of the sequences that are created

Tim Roberts Over a year ago

Then that's not random. When you interfere with uniform randomness, then it's no longer uniform.

charles · Accepted Answer · 2021-05-11 04:00:35Z

1

How about something like :

import re

concatenated = ["A"]*20 + ["T"]*20 + ["G"]*30 + ["C"]*30
while True:
    random.shuffle(concatenated)
    sequence = "".join(concatenated)
    # exit the loop since we have found a sequence not containing more than 10 repeats of any letter
    if not re.search("A{11,}|T{11,}|G{11,}|C{11,}", sequence):
        break

This will run until you find a sequence not containing more than 10 repeats in a row of any letter.

edited May 11, 2021 at 4:00

answered May 11, 2021 at 3:53

charles

1,0555 silver badges10 bronze badges

2 Comments

Paolo Lorenzini Over a year ago

but in this case, I get an out put with sequences with different lengths, I want each sequence to be the same length, in this example is set to 100

Sam Mason Over a year ago

@PaoloLorenzini this should always give 100 elements back. This is doing the same as Jamie Deith's answer, just much more succinctly

Collectives™ on Stack Overflow

eliminate repeats in random module in python

3 Answers 3

3 Comments

4 Comments

2 Comments

Your Answer

Hot Network Questions

Collectives™ on Stack Overflow

3 Answers 3

3 Comments

4 Comments

2 Comments

Your Answer

Sign up or log in

Post as a guest

Related