0

I have two python dictionary variables. One is a dict with IDs as keys and long strings as values, the other one is a dict with different type of IDs as keys and list as values.

They look like this:

**dContigData** 
Chromosome_8.8 AAACGCAATAACCAGAAAACCAATTTTTAAAATATTAAACCCAACGAAAT...
Chromosome_8.4 CCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCC...
Chromosome_8.5 CTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCT...
Chromosome_8.6 GCCTGCTCGTAACCCTGACTCGTCCACCCCCAATCCGTCACCCCATTAAT...
Chromosome_8.7 CCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACC...
Chromosome_8.1 TCGCTTCGGCGGTCCTGCGGCATCTTTGTACTTCTTGTGGAAGTCGTCAA...
Chromosome_8.2 CCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACC...
Chromosome_8.3 TAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTA...

and the other:

e = dict() # temporary dictionary variable:
MGG_08464T0 ['Chromosome_8.4', 306312, 306647, 306759, 307475]
MGG_06151T0 ['Chromosome_8.3', 2749586, 2750617]
MGG_07594T0 ['Chromosome_8.3', 1141635, 1142444]
MGG_13455T0 ['Chromosome_8.3', 1512811, 1512907, 1513002, 1513487, 1513578, 1513822, 1514067, 1514645]
MGG_00992T0 ['Chromosome_8.5', 896033, 896144, 896226, 896573, 896655, 897307]
MGG_04622T0 ['Chromosome_8.1', 7084849, 7084958, 7085037, 7085724]

So, I have written code to print the key from "dict e" and substring of dContigData value from "dict e" value[1]-1 (306311 in the first case, subtract 1 because of python position) to value[-1] (307475 in the first case). However, the values in a list are not in the same length, although the position information elements (the elements just after the first element in the list. e.g. Chromosome_8.X) are always in pairs. Actually, what I want to do is iterate the position information elements in each list and substring the string of dContigData.

My code:

dContigData = readContigFasta()

#for key in dContigData:
#    print(key, dContigData[key][0:50]+"...")

for key in e:
    for contigID in dContigData:
        if e[key][0] == contigID:
            #print (key, e[key])
            print (key, dContigData[contigID][e[key][1]-1:e[key][-1]]) # -1 for start base 0

EDIT: Okay, many of you do not get my question, so if you do not understand the above mumbles, just concentrate on the end result below, please. ;)

Result supposed to be (for example as the 5th in "dict e" with 3 pieces):

e.g.

MGG_00992T0 [896032]ATGGGCATTTCGGCTCGGGTCAGTAC[896144]...[896225]GCTGACCCATTACAGGTTGGGGGCTTTAA[896573]...[896654]ACCAAAGTTCCCACTTGTCCCCTGGGACCGAGATGTCCAACAATGA[897307]

[number] and ... for easier understanding (supposed to NOT be included)

Any idea to substring a string and then concatenate back to a string while looping?

2
  • A comment on your code: you don't need an inner loop, use e[key][0] instead of contigID. Then I didn't understand your question, what do you mean by position information elements? Could you explain what you're trying to achieve again? I guess it has something to do with the position numbers in the list others than the first and last elements but I'm not sure how you want to use them. Commented Jul 21, 2014 at 7:28
  • Thank you for your interest @Thibault. I have changed the question a bit for easier understading. What I would like to do is cut the string with above position info and concatenate the cut string into one. Commented Jul 21, 2014 at 7:58

5 Answers 5

2

Here is a simplified version of your question, illustrating what I think you're looking for based on the pre-edit question, and using the full alphabet instead of DNA to make positions clearer. (Please see the help files regarding how to write a useful minimal example.)

dContigData = {
    "chromo_1": "abcdefghij",
    "chromo_2": "ABCDEFGHIJ"
}

e = {
    "mgg_1": ["chromo_1", 2, 4, 7, 9],
    "mgg_2": ["chromo_2", 1, 5, 8, 10]
}

Desired output:

mgg_1
bcd...ghi
mgg_2
ABCDE...HIJ

If this is what you mean, this Python 3 code will produce that output. Note that dictionary keys are not in any particular order. You may prefer to use a list of lists for e, rather than a dictionary of lists, since you seem to only be iterating over it anyway.

for mgg in sorted(e):
    lst = e[mgg]
    chrom = lst[0]
    substrings = []
    for i in range(1, len(lst), 2):
        startpos, endpos = lst[i:i+2]
        substrings.append(dContigData[chrom][startpos-1:endpos])
    print("{}\n{}".format(mgg, "".join(substrings)))
Sign up to request clarification or add additional context in comments.

3 Comments

Thank you for your answer. You properly understood. But, ... is unnecessary ("".join(substrings) will do) and your output comes out to be chromo_1 bcdghi / chromo_2 ABCDEHIJ, NOT in mgg.
+1 for the mcve, it even helped me to understand what the OP wanted and propose another answer. @Karyo that's a small typo, print mgg instead of printing chrom
@Karyo: Whoops, overlooked using the wrong variable there. Thanks. Fixed both points.
1

If I understand your question correctly, this should do it:

for key, value in e.items():
    print(
        key,
        dContigData[value[0]][value[1]-1:value[-1]]
    )

Comments

1

A more general solution:

import itertools


def group(lst, n):
    """Group an iterable into an n-tuples iterable. Incomplete tuples
    are discarded e.g.

    >>> list(group(range(10), 2))
    [(0, 1), (2, 3), (4, 5), (6, 7), (8, 9)]
    >>> list(group(range(10), 3))
    [(0, 1, 2), (3, 4, 5), (6, 7, 8)]
    """
    return itertools.izip(*[itertools.islice(lst, i, None, n)
                          for i in range(n)])


for key in e:
    sub_str_list = []
    contigID = e[key][0]
    for start, end in group(e[key][1:], 2):
        sub_str_list.append(dContigData[contigID][start-1:end])
    print(contigID, '...'.join(sub_str_list))

Comments

1

Based on your edits, I think this should do what you need. I have used Tom's simplified version of your question which was much more explicit to explain things

dContigData = {
    "chromo_1": "abcdefghij",
    "chromo_2": "ABCDEFGHIJ"
}

e = {
    "mgg_1": ["chromo_1", 2, 4, 7, 9],
    "mgg_2": ["chromo_2", 1, 5, 8, 10]
}

# Iterate over the items (keys/values) of e dictionary
for key, value in e.items():
    # Store in a variable for easier understanding
    string = dContigData[value[0]]
    # Get a list of tuples of (start, end) positions for the substrings
    # Example for mgg_1: zip([2,7], [4,9]) = [(2,4), (7,9)] 
    subPositions = zip(value[1::2], value[2::2])
    # Join the substrings for all these pairs
    # (most efficient string concatenation)
    res = ''.join([string[val[0]-1:val[1]] for val in subPositions])
    print key
    print res

Output:

mgg_2
ABCDEHIJ
mgg_1
bcdghi

This won't guarantee the order of iteration so if this is somethings important to you, you can simply use a sorted iterator iter(sorted(e.items()))

Comments

1

"Any idea to substring a string and then concatenate back to a string while looping?"

don't know if i understood your question, but

# sep = "..."
for key in e:
    for contigID in dContigData:
        if e[key][0] == contigID:
            dnaSeq = ''
            starts = [x-1 for x in e[key][1::2]]
            ends =  e[key][2::2]
            for i in range(len(starts)):
                dnaSeq += dContigData[contigID][starts[i]:ends[i]]
                #if i<len(starts)-1:
                #   dnaSeq += sep 
            print (key, '\n', dnaSeq)

should bring you the supposed result.

Update: Taking into account your last edits, you might skip the 'sep' steps and you'll get dnaSeq consisting of the pieces without any separators between the parts.

Comments

Your Answer

By clicking “Post Your Answer”, you agree to our terms of service and acknowledge you have read our privacy policy.

Start asking to get answers

Find the answer to your question by asking.

Ask question

Explore related questions

See similar questions with these tags.