python fuzzy regex with nested or regex

Question

I'm trying to do some fuzzy matching on a string of DNA reads. I'd like to allow for up to 1 substitution error while at the same time allowing a particular basepair to be one of two options (A or G in this case).

I've started with the following:

>>> regex.findall("([A|G]TTAGATACCCTGGTAGTCC){0<=s<=1}", "ATTAGATACCCTGGTAGTCA")
['ATTAGATACCCTGGTAGTCA']

matches as expected because I'm matching against the exact string

>>> regex.findall("([A|G]TTAGATACCCTGGTAGTCC){0<=s<=1}", "GTTAGATACCCTGGTAGTCA")
['GTTAGATACCCTGGTAGTCA']

matches as expected because I'm matching against the exact string except the first base pair has been switched from an A to a G (allowed)

>>> regex.findall("([A|G]TTAGATACCCTGGTAGTCC){0<=s<=1}", "GTTAGATACCCTGGTAGTCx")
['GTTAGATACCCTGGTAGTCx']

matches as expected because a single substitution occurs (C->x)

>>> regex.findall("([A|G]TTAGATACCCTGGTAGTCC){0<=s<=1}", "xTTAGATACCCTGGTAGTCx")
[]

does not match (as expected) because there are two substitutions

>>> regex.findall("([A|G]TTAGATACCCTGGTAGTCC){0<=s<=1}", "xTTAGATACCCTGGTAGTCA")
[]

should have matched, since the first basepair error (x instead of A or G) should have been counted as a substitution.

Henry Keiter · Accepted Answer · 2016-04-04 16:15:32Z

0

You have two substitutions in your last example: the first basepair has been substituted with an x while the last has been changed to an A. You only allow one substitution, so there's no match.

answered Apr 4, 2016 at 16:15

Henry Keiter

17.3k8 gold badges53 silver badges85 bronze badges

Sign up to request clarification or add additional context in comments.

Collectives™ on Stack Overflow

python fuzzy regex with nested or regex

1 Answer 1

Comments

Your Answer

Hot Network Questions

Collectives™ on Stack Overflow

1 Answer 1

Comments

Your Answer

Sign up or log in

Post as a guest

Related