Longest and shortest sequence, Python

Question

I have this program to generate random N sequences.

import random
N = 5
def randseq(abc, length):
    return "".join([random.choice(abc) for i in range(random.randint(1, length))])
for i in range(N):
    print(f'Sequence {i+1}:')
    print(randseq("ATCG", 120))

I got the sequences

Sequence 1:

TGGTACACGTGCTTAATGTTAACCTGTCTGGCGCAGGGTAACTATTTCATCCCT

Sequence 2:

CGTATATAATGCTTCCTCTTCAGGCGACCTTGCGATAGTGTCCGGCCATGTGAGTCCCTGTGGAGTGCCTTTAGATGACCTATACGTCTTTAGACTATGTTTATGGGG

Sequence 3:

CACAGCCTTCCTCCAATG . . .

Sequence N:

How can I print the longest and shortest N sequences and their lengths?

....

Create variables like e. g. "seq_min" and "seq_max" by assigning the first sequence to them and while iterating through the remaining sequences compare length of current sequence with length of seq_min/seq_max and if the sequence is shorter/longer set seq_min/seq_max to this found sequence. — Michael Butscher
– Michael Butscher, Commented Oct 9, 2021 at 3:09
@MichaelButscher Could you tell me how to assign the first sequence to the variables? Sorry, I am new in this field :/ — Vykov
– Vykov, Commented Oct 9, 2021 at 3:56
seq_max = seq_min = randseq("ATCG", 120). If not done already you should work through the Python tutorial. — Michael Butscher
– Michael Butscher, Commented Oct 9, 2021 at 4:32

Unknown N · Accepted Answer · 2021-10-09 05:17:59Z

Please check on my code. The descriptions are inside there.

import random


def randseq(abc, length):
    return "".join([random.choice(abc) for i in range(random.randint(1, length))])


# You should move the input value to the main part of code
# If not, it will treat as global variable
N = 5

# Init the longest seq with shortest one (empty string) 
# to make sure that all random seq must longer than this init
longest_seq = ""

# Init the shortest seq with longest one 
# (assume that randseq("ATCG", 1000) is long enough) 
# to make sure that all random seq must shorter than this init
shortest_seq = randseq("ATCG", 1000)

for i in range(N):
    print(f'Sequence {i+1}:')
    seq = randseq("ATCG", 120)
    
    # Find the longest one then update it to the longest_seq variable
    if len(seq) > len(longest_seq):
        longest_seq = seq
    
    # Find the shortest one then update it to the shortest_seq variable
    if len(seq) < len(shortest_seq):
        shortest_seq = seq
    
    print(seq)
   
print("") 
print('The longest seq is ', longest_seq)
print('The lenght of longest seq is ', len(longest_seq))
print('The shortest is ', shortest_seq)
print('The lenght of shortest seq is ', len(shortest_seq))

Example result (it's random, so it will not same as you when you run it)

Sequence 1:
CGGTGATCGCGATTACTGCCCGGCCTTGTCCACTCACAGCGATAACAGTGCTTATAGATCTCTCAAGTCTACCGTCTCACCCGTTGATTACCAA
Sequence 2:
AAGGTCAAGATTCGAATTCGTATCGCCGTATGGATAGGCGAAACGAGGGGTGGCTAAGGGGTAGACAGCAGAGCCGCTTTTGTACACCGTAAAACGGACGGTTCAGAACCGGAGGTACG
Sequence 3:
ACGGCCTCATGGATAATGCCCGGGGGAACAGGGAAGGAAAGATTTTGTCAAACTGATTCAGTTAC
Sequence 4:
GATACA
Sequence 5:
ATCGAAAGGAATATCTGTACGGGACGTTTGGTCTCGAGCCTAGCGTAAGCCGCCCGCAATTCGCTCTGATGAGCTACCG

The longest seq is  AAGGTCAAGATTCGAATTCGTATCGCCGTATGGATAGGCGAAACGAGGGGTGGCTAAGGGGTAGACAGCAGAGCCGCTTTTGTACACCGTAAAACGGACGGTTCAGAACCGGAGGTACG
The lenght of longest seq is  119
The shortest is  GATACA
The lenght of shortest seq is  6

Precaution:

In some (rarely) case, the initialization of shortest_seq might be too small (smallest among all random seq). If this case occur, the program will be failed. You can increase the length of randseq input to reduce the possibility to encounter with this problem.

For example.

You can change it from:

shortest_seq = randseq("ATCG", 1000)

to:

shortest_seq = randseq("ATCG", 10000)

Collectives™ on Stack Overflow

Longest and shortest sequence, Python

1 Answer 1

Comments

Your Answer

Hot Network Questions

Collectives™ on Stack Overflow

1 Answer 1

Comments

Your Answer

Sign up or log in

Post as a guest

Related